circad | circRNAs associated with diseases

circFARSA
Gene	FARSA	Organism	Human
Genome Locus	exon 5-7 of the FARSA gene	Build	hg19
Disease	Non-Small cell Lung Cancer tumorigenesis	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29722168
Experimental Method
Sample Type	Tissues	Comparison	cancerous and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTCCTTCTGGAACTTTGAC Reverse TTGCTCACCCAGTAGGTCTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Hang, D, Zhou, J, Qin, N, Zhou, W, Ma, H, Jin, G, Hu, Z, Dai, J, Shen, H (2018). A novel plasma circular RNA circFARSA is a potential biomarker for non-small cell lung cancer. Cancer Med, 7, 6:2783-2791.